Daily Schedule 2019-2020
Week 26: 3/16-3/20
Monday 3/16
NO SCHOOL- SPRING BREAK
Tuesday 3/17
Objective: E-learning day to take attendance and optionally review material
Daily Warm-up: None
Lesson:
1) Click here for e-learning day lesson
HW: Take attendance
Wednesday 3/18
SCHOOL CANCELLED
Thursday 3/19 or Friday 3/20
SCHOOL CANCELLED
NO SCHOOL- SPRING BREAK
Tuesday 3/17
Objective: E-learning day to take attendance and optionally review material
Daily Warm-up: None
Lesson:
1) Click here for e-learning day lesson
HW: Take attendance
Wednesday 3/18
SCHOOL CANCELLED
Thursday 3/19 or Friday 3/20
SCHOOL CANCELLED
Week 25: 3/2-3/5
Monday 3/2
Objective: Describe the endocrine system
Daily Warm-up: Describe the steps of an action potential, w/o notes
Lesson:
1) Endocrine system
HW: Read 32.2-32.3
Tuesday 3/3
Objective: Describe osmoregulation
Daily Warm-up: Describe how hormones have multiple effects
Lesson:
1) Osmoregulation
HW: Finish 32
Wednesday 3/4
Objective: Describe innate immunity
Daily Warm-up: What are the three types of nitrogenous waste elimination forms?
Lesson:
1) Innate notes
2) Video
HW: Read 35.1 and 35.2
Thursday 3/5
Objective: Describe humoral immunity
Daily Warm-up: What is the general idea of innate immunity?
Lesson:
1) Humoral notes
2) Modeling
3) Video
HW: Read 35.3
Objective: Describe the endocrine system
Daily Warm-up: Describe the steps of an action potential, w/o notes
Lesson:
1) Endocrine system
HW: Read 32.2-32.3
Tuesday 3/3
Objective: Describe osmoregulation
Daily Warm-up: Describe how hormones have multiple effects
Lesson:
1) Osmoregulation
HW: Finish 32
Wednesday 3/4
Objective: Describe innate immunity
Daily Warm-up: What are the three types of nitrogenous waste elimination forms?
Lesson:
1) Innate notes
2) Video
HW: Read 35.1 and 35.2
Thursday 3/5
Objective: Describe humoral immunity
Daily Warm-up: What is the general idea of innate immunity?
Lesson:
1) Humoral notes
2) Modeling
3) Video
HW: Read 35.3
Week 24: 2/24-2/28
Monday 2/24
Objective: Describe homeostasis
Daily Warm-up: What do you know about homeostasis?
Lesson:
1) Homeostasis discussion
2) Homeostasis lab
HW: Read 32.1
Tuesday 2/25
Objective: Describe homeostasis
Daily Warm-up: What is the difference between positive and negative feedback?
Lesson:
1) Homeostasis lab
HW: Lab due block day
Wednesday 2/26
Objective: Describe the nervous system
Daily Warm-up: What is the basic cell of the nervous system?
Lesson:
1) Nervous system notes
2) Labeling
HW: Read 37.1-37.2
Thursday 2/27 or Friday 2/28
Objective: Describe the action potential
Daily Warm-up: What are the following structures?
Lesson:
1) Action potential notes
2) Modeling
3) Video
4) Fake quiz
HW: Read rest of 37
Objective: Describe homeostasis
Daily Warm-up: What do you know about homeostasis?
Lesson:
1) Homeostasis discussion
2) Homeostasis lab
HW: Read 32.1
Tuesday 2/25
Objective: Describe homeostasis
Daily Warm-up: What is the difference between positive and negative feedback?
Lesson:
1) Homeostasis lab
HW: Lab due block day
Wednesday 2/26
Objective: Describe the nervous system
Daily Warm-up: What is the basic cell of the nervous system?
Lesson:
1) Nervous system notes
2) Labeling
HW: Read 37.1-37.2
Thursday 2/27 or Friday 2/28
Objective: Describe the action potential
Daily Warm-up: What are the following structures?
Lesson:
1) Action potential notes
2) Modeling
3) Video
4) Fake quiz
HW: Read rest of 37
Week 23: 2/17-2/21
Monday 2/17
NO SCHOOL- PRESIDENT'S DAY
Tuesday 2/18
Objective: Describe early earth conditions
Daily Warm-up: What are the 3 outcomes of hybrid zones?
Lesson:
1) Early earth notes
2) Bacteria discussion
HW: Read 23.3-23.4, 24
Wednesday 2/19
Objective: Review for the test
Daily Warm-up: What are the 3 ways bacteria increase their genetic diversity?
Lesson:
1) Review
HW: Read 25.1
Thursday 2/20 or Friday 2/21
Objective: Apply knowledge on the test
Daily Warm-up: What is transduction?
Lesson:
1) Unit 6 Part II Test
HW: Read 32.1
NO SCHOOL- PRESIDENT'S DAY
Tuesday 2/18
Objective: Describe early earth conditions
Daily Warm-up: What are the 3 outcomes of hybrid zones?
Lesson:
1) Early earth notes
2) Bacteria discussion
HW: Read 23.3-23.4, 24
Wednesday 2/19
Objective: Review for the test
Daily Warm-up: What are the 3 ways bacteria increase their genetic diversity?
Lesson:
1) Review
HW: Read 25.1
Thursday 2/20 or Friday 2/21
Objective: Apply knowledge on the test
Daily Warm-up: What is transduction?
Lesson:
1) Unit 6 Part II Test
HW: Read 32.1
Week 22: 2/10-2/14
Monday 2/10
Objective: Apply knowledge on the test
Daily Warm-up: None
Lesson:
1) Unit 6 Part I Test
HW: Take-home test
Tuesday 2/11
Objective: Describe speciation
Daily Warm-up: What are 2 closely related species that you can think of?
Lesson:
1) Speciation notes
2) Speciation flow chart
HW: Read 22.1-22.2
Wednesday 2/12
Objective: Describe speciation
Daily Warm-up: What is the difference between allopatric and sympatric speciation?
Lesson:
1) Hybrid zones
HW: Read 22.3 and 22.4
Thursday 2/13
Objective: Describe early Earth's history
Daily Warm-up: What are the 3 outcomes of a hybrid zone?
Lesson:
1) Fossils
2) Questions
HW: Read 23.1-23.2
Objective: Apply knowledge on the test
Daily Warm-up: None
Lesson:
1) Unit 6 Part I Test
HW: Take-home test
Tuesday 2/11
Objective: Describe speciation
Daily Warm-up: What are 2 closely related species that you can think of?
Lesson:
1) Speciation notes
2) Speciation flow chart
HW: Read 22.1-22.2
Wednesday 2/12
Objective: Describe speciation
Daily Warm-up: What is the difference between allopatric and sympatric speciation?
Lesson:
1) Hybrid zones
HW: Read 22.3 and 22.4
Thursday 2/13
Objective: Describe early Earth's history
Daily Warm-up: What are the 3 outcomes of a hybrid zone?
Lesson:
1) Fossils
2) Questions
HW: Read 23.1-23.2
Week 21: 2/3-2/7
Monday 2/3
Objective: Conduct a lab focusing on phylogeny.
Daily Warm-up: What is a homoplasy?
Lesson:
1) BLAST lab
HW: Nothing
Tuesday 2/4
Objective: Describe microevolution.
Daily Warm-up: What might microevolution be?
Lesson:
1) Microevolution notes
2) Hardy-Weinberg practice
HW: Read 21.1, brine shrimp lab due tomorrow, H-W questions attempted
Wednesday 2/5
Objective: Complete H-W situations
Daily Warm-up: What are the 5 requirements needed for H-W to not occur?
Lesson:
1) Hardy-Weinberg practice
HW: Read 21.2
Thursday 2/6 or Friday 2/7
Objective: Complete H-W situations
Daily Warm-up: What does the p represent?
Lesson:
1) Mechanisms
2) Chi-square
HW: Read rest of 21, test on Monday
Objective: Conduct a lab focusing on phylogeny.
Daily Warm-up: What is a homoplasy?
Lesson:
1) BLAST lab
HW: Nothing
Tuesday 2/4
Objective: Describe microevolution.
Daily Warm-up: What might microevolution be?
Lesson:
1) Microevolution notes
2) Hardy-Weinberg practice
HW: Read 21.1, brine shrimp lab due tomorrow, H-W questions attempted
Wednesday 2/5
Objective: Complete H-W situations
Daily Warm-up: What are the 5 requirements needed for H-W to not occur?
Lesson:
1) Hardy-Weinberg practice
HW: Read 21.2
Thursday 2/6 or Friday 2/7
Objective: Complete H-W situations
Daily Warm-up: What does the p represent?
Lesson:
1) Mechanisms
2) Chi-square
HW: Read rest of 21, test on Monday
Week 20: 1/27-1/31
Monday 1/27
Objective: Describe natural selection
Daily Warm-up: What is an example of an adaptation?
Lesson:
1) Brine shrimp set up
HW: Nothing
Tuesday 1/28
Objective: Conduct an experiment focusing on natural selection
Daily Warm-up: What is one thing needed for natural selection?
Lesson:
1) Lab
HW: Ch. 20.1 questions
Wednesday 1/29
Objective: Conduct an experiment focusing on natural selection
Daily Warm-up: What is one thing needed for natural selection?
Lesson:
1) Lab
HW: Nothing
Thursday 1/30 or Friday 1/31
Objective: Describe phylogeny.
Daily Warm-up: What is the difference between homologous and analogous structures?
Lesson:
1) Review the past few days (Albers was absent)
2) BLAST lab
HW: Read rest of Ch.20, Mastering Biology Ch. 20 questions due Sunday at 11:59 pm
Objective: Describe natural selection
Daily Warm-up: What is an example of an adaptation?
Lesson:
1) Brine shrimp set up
HW: Nothing
Tuesday 1/28
Objective: Conduct an experiment focusing on natural selection
Daily Warm-up: What is one thing needed for natural selection?
Lesson:
1) Lab
HW: Ch. 20.1 questions
Wednesday 1/29
Objective: Conduct an experiment focusing on natural selection
Daily Warm-up: What is one thing needed for natural selection?
Lesson:
1) Lab
HW: Nothing
Thursday 1/30 or Friday 1/31
Objective: Describe phylogeny.
Daily Warm-up: What is the difference between homologous and analogous structures?
Lesson:
1) Review the past few days (Albers was absent)
2) BLAST lab
HW: Read rest of Ch.20, Mastering Biology Ch. 20 questions due Sunday at 11:59 pm
Week 19: 1/22-1/24
Monday 1/20
No School- MLK Jr. Day
Tuesday 1/21
No School
Wednesday 1/22
Objective: Describe natural selection
Daily Warm-up: What did Lamarck say?
Lesson:
1) Natural selection overview
HW: Read 19.2
Thursday 1/23 or Friday 1/24
Objective: Prepare for the brine shrimp lab
Daily Warm-up: What is needed for natural selection to occur?
Lesson:
1) Evidence of evolution
2) Brine shrimp set up
HW: Finish Ch. 19
No School- MLK Jr. Day
Tuesday 1/21
No School
Wednesday 1/22
Objective: Describe natural selection
Daily Warm-up: What did Lamarck say?
Lesson:
1) Natural selection overview
HW: Read 19.2
Thursday 1/23 or Friday 1/24
Objective: Prepare for the brine shrimp lab
Daily Warm-up: What is needed for natural selection to occur?
Lesson:
1) Evidence of evolution
2) Brine shrimp set up
HW: Finish Ch. 19
Week 18: 1/13-1/17
Monday 1/13
Objective: Describe viruses
Daily Warm-up: What is induction?
Lesson:
1) Viruses
HW: Read 17.1
Tuesday 1/14
Objective: Describe viruses
Daily Warm-up: What are the 2 reproductive cycles of a virus?
Lesson:
1) Finish viruses
HW: Finish 17
Wednesday 1/15
Objective: Review for the test on block day
Daily Warm-up: What is coordinately controlled?
Lesson:
1) Jeopardy review
HW: Study for the test on block day
Thursday 1/16 or Friday 1/17
Objective: Apply knowledge on the test. Describe natural selection.
Daily Warm-up: Nothing- begin test.
Lesson:
1) Unit 5 Test
2) Natural selection notes and videos
HW: Read Ch. 19.1
Objective: Describe viruses
Daily Warm-up: What is induction?
Lesson:
1) Viruses
HW: Read 17.1
Tuesday 1/14
Objective: Describe viruses
Daily Warm-up: What are the 2 reproductive cycles of a virus?
Lesson:
1) Finish viruses
HW: Finish 17
Wednesday 1/15
Objective: Review for the test on block day
Daily Warm-up: What is coordinately controlled?
Lesson:
1) Jeopardy review
HW: Study for the test on block day
Thursday 1/16 or Friday 1/17
Objective: Apply knowledge on the test. Describe natural selection.
Daily Warm-up: Nothing- begin test.
Lesson:
1) Unit 5 Test
2) Natural selection notes and videos
HW: Read Ch. 19.1
Week 17: 1/6-1/10
Monday 1/6
Objective: Describe prokaryotic gene regulation
Daily Warm-up: Why would genes need to be regulated?
Lesson:
1) Pass back tests
2) Prokaryotic gene regulation
HW: Read 15.1, TC due 1/13
Tuesday 1/7
Objective: Describe prokaryotic gene regulation
Daily Warm-up: What are the 3 parts to an operon?
Lesson:
1) Lac Operon
HW: Read 15.2
Wednesday 1/8
Objective: Describe eukaryotic gene regulation
Daily Warm-up: What happens in a repressible operon?
Lesson:
1) Eukaryotic gene regulation
2) Stickleback video
HW: Read 15.3
Thursday 1/9 or Friday 1/10
Objective: Describe organismal development
Daily Warm-up: What is the purpose of transcription factors?
Lesson:
1) Stickleback questions
2) Ch. 16
HW: Read Ch. 16, stickleback questions, Test corrections due Monday
Objective: Describe prokaryotic gene regulation
Daily Warm-up: Why would genes need to be regulated?
Lesson:
1) Pass back tests
2) Prokaryotic gene regulation
HW: Read 15.1, TC due 1/13
Tuesday 1/7
Objective: Describe prokaryotic gene regulation
Daily Warm-up: What are the 3 parts to an operon?
Lesson:
1) Lac Operon
HW: Read 15.2
Wednesday 1/8
Objective: Describe eukaryotic gene regulation
Daily Warm-up: What happens in a repressible operon?
Lesson:
1) Eukaryotic gene regulation
2) Stickleback video
HW: Read 15.3
Thursday 1/9 or Friday 1/10
Objective: Describe organismal development
Daily Warm-up: What is the purpose of transcription factors?
Lesson:
1) Stickleback questions
2) Ch. 16
HW: Read Ch. 16, stickleback questions, Test corrections due Monday
Week 16: 12/16-12/20
Monday 12/16
Objective: Make conclusions about the lab
Daily Warm-up: What is aneuploidy?
Lesson:
1) Transformation lab work time
HW: Lab due block day (no one-day late)
Tuesday 12/17
Objective: Review for the test
Daily Warm-up: What happens in a nonsense mutation?
Lesson:
1) Jeopardy review
HW: Test tomorrow
Wednesday 12/18
Objective: Apply knowledge on the test
Daily Warm-up: Nothing- Albers gone
Lesson:
1) Unit 4 Test
HW: Nothing
Thursday 12/19 or Friday 12/20
Objective: Perform gel electrophoresis
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Gel electrophoresis lab
HW: Nothing! Happy break!
Objective: Make conclusions about the lab
Daily Warm-up: What is aneuploidy?
Lesson:
1) Transformation lab work time
HW: Lab due block day (no one-day late)
Tuesday 12/17
Objective: Review for the test
Daily Warm-up: What happens in a nonsense mutation?
Lesson:
1) Jeopardy review
HW: Test tomorrow
Wednesday 12/18
Objective: Apply knowledge on the test
Daily Warm-up: Nothing- Albers gone
Lesson:
1) Unit 4 Test
HW: Nothing
Thursday 12/19 or Friday 12/20
Objective: Perform gel electrophoresis
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Gel electrophoresis lab
HW: Nothing! Happy break!
Week 15: 12/9-12/13
Monday 12/9
Objective: Review translation
Daily Warm-up: Translate the following sequence 3' ATCTACAAAACAACATACACTCAT 5'
Lesson:
1) Review translation
2) Codon bingo
HW: Read 14.2 and 14.3, Mastering Biology questions due Wednesday at 11:59 pm
Tuesday 12/10
Objective: Describe mutations
Daily Warm-up: What does a mutation do?
Lesson:
1) Mutation notes
2) Mutation problems
HW: Finish Ch. 14, Mastering Biology questions due Wednesday at 11:59 pm
Wednesday 12/11
Objective: Prepare for the transformation lab
Daily Warm-up: What is transformation?
Lesson:
1) Transformation lab preparation
HW: Lab prepped for block day, Mastering Biology questions due Wednesday at 11:59 pm
Thursday 12/12 or Friday 12/13
Objective: Perform a transformation lab
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Transformation lab
HW: Nothing! But test is on Tuesday..
Objective: Review translation
Daily Warm-up: Translate the following sequence 3' ATCTACAAAACAACATACACTCAT 5'
Lesson:
1) Review translation
2) Codon bingo
HW: Read 14.2 and 14.3, Mastering Biology questions due Wednesday at 11:59 pm
Tuesday 12/10
Objective: Describe mutations
Daily Warm-up: What does a mutation do?
Lesson:
1) Mutation notes
2) Mutation problems
HW: Finish Ch. 14, Mastering Biology questions due Wednesday at 11:59 pm
Wednesday 12/11
Objective: Prepare for the transformation lab
Daily Warm-up: What is transformation?
Lesson:
1) Transformation lab preparation
HW: Lab prepped for block day, Mastering Biology questions due Wednesday at 11:59 pm
Thursday 12/12 or Friday 12/13
Objective: Perform a transformation lab
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Transformation lab
HW: Nothing! But test is on Tuesday..
Week 14: 12/2-12/6
Monday 12/2
Objective: Review DNA replication
Daily Warm-up: Draw a replication fork and label everything
Lesson:
1) Review DNA replication with around the room flash cards
2) Draw replication fork
HW: Read 13.3 and 13.4, Mastering Biology questions due Saturday at 11:59 pm
Tuesday 12/3
Objective: Describe genetic engineering
Daily Warm-up: What is the role of primase?
Lesson:
1) Genetic engineering notes
2) Golden Rice
HW: Nothing
Wednesday 12/4
Objective: Describe transcription
Daily Warm-up: What is aneuploidy?
Lesson:
1) Transcription notes
2) Transcription practice
HW: Read 14.1 and 14.2
Thursday 12/5 or Friday 12/6
Objective: Describe translation.
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Translation notes
2) Translation practice
HW: Read 14.3, finish Ch. 13 questions by Saturday at 11:59 pm
Objective: Review DNA replication
Daily Warm-up: Draw a replication fork and label everything
Lesson:
1) Review DNA replication with around the room flash cards
2) Draw replication fork
HW: Read 13.3 and 13.4, Mastering Biology questions due Saturday at 11:59 pm
Tuesday 12/3
Objective: Describe genetic engineering
Daily Warm-up: What is the role of primase?
Lesson:
1) Genetic engineering notes
2) Golden Rice
HW: Nothing
Wednesday 12/4
Objective: Describe transcription
Daily Warm-up: What is aneuploidy?
Lesson:
1) Transcription notes
2) Transcription practice
HW: Read 14.1 and 14.2
Thursday 12/5 or Friday 12/6
Objective: Describe translation.
Daily Warm-up: What is the Central Dogma?
Lesson:
1) Translation notes
2) Translation practice
HW: Read 14.3, finish Ch. 13 questions by Saturday at 11:59 pm
Week 13: 11/25-11/26
Monday 11/25
Objective: Describe DNA experiments and work on X2
Daily Warm-up: Who had 2 rules?
Lesson:
1) DNA experiment presentation finish if needed
2) Finish X2 questions
HW: X2 questions
Tuesday 11/26
Objective: Describe the structure of DNA and the process of DNA replication
Daily Warm-up: What does it mean to be anti-parallel?
Lesson:
1) Structure modeling
2) DNA replication
HW: Read 13.2
Objective: Describe DNA experiments and work on X2
Daily Warm-up: Who had 2 rules?
Lesson:
1) DNA experiment presentation finish if needed
2) Finish X2 questions
HW: X2 questions
Tuesday 11/26
Objective: Describe the structure of DNA and the process of DNA replication
Daily Warm-up: What does it mean to be anti-parallel?
Lesson:
1) Structure modeling
2) DNA replication
HW: Read 13.2
Week 12: 11/18-11/22
Monday 11/18
Objective: Apply knowledge on the test
Daily Warm-up: Nothing, begin test right away
Lesson:
1) Unit 3 Test
HW: Nothing
Tuesday 11/19
Objective: Describe sex-linked traits.
Daily Warm-up: What are the sex chromosomes of the male vs. female?
Lesson:
1) Sex-linked notes
2) Practice
HW: Read 12.1 and 12.2
Wednesday 11/20
Objective: Describe linked genes
Daily Warm-up: Solve this X2 problem:
Lesson:
1) Linked genes and X2
HW: Read 12.3
Thursday 11/21 or Friday 11/22
Objective: Describe the various experiments that led to the discovery of DNA.
Daily Warm-up: What do you know about DNA?
Lesson:
1) DNA posters
HW: Finish Ch. 12, read 13.1, finish questions on DNA discoveries
Objective: Apply knowledge on the test
Daily Warm-up: Nothing, begin test right away
Lesson:
1) Unit 3 Test
HW: Nothing
Tuesday 11/19
Objective: Describe sex-linked traits.
Daily Warm-up: What are the sex chromosomes of the male vs. female?
Lesson:
1) Sex-linked notes
2) Practice
HW: Read 12.1 and 12.2
Wednesday 11/20
Objective: Describe linked genes
Daily Warm-up: Solve this X2 problem:
Lesson:
1) Linked genes and X2
HW: Read 12.3
Thursday 11/21 or Friday 11/22
Objective: Describe the various experiments that led to the discovery of DNA.
Daily Warm-up: What do you know about DNA?
Lesson:
1) DNA posters
HW: Finish Ch. 12, read 13.1, finish questions on DNA discoveries
Week 11: 11/11-11/15
Monday 11/11
Objective: Describe genetics
Daily Warm-up: What is the purpose of a testcross? How does it work?
Lesson:
1) Continue genetics
2) Genetics practice
HW: Read 11.3
Tuesday 11/12
Objective: Describe pedigrees.
Daily Warm-up: What is the purpose of a pedigree?
Lesson:
1) Continue genetics
2) Genetics practice
HW: Nothing
Wednesday 11/13
Objective:
Daily Warm-up: What might be the purpose of statistics??
Lesson:
1) Pedigree questions
HW: Finish Ch. 11
Thursday 11/14 or Friday 11/15
Objective: Perform a Chi-square test. Practice for the test.
Daily Warm-up: What type of trait is this?
Lesson:
1) Chi-square activity
2) Review for the test
HW: Test on Monday
Objective: Describe genetics
Daily Warm-up: What is the purpose of a testcross? How does it work?
Lesson:
1) Continue genetics
2) Genetics practice
HW: Read 11.3
Tuesday 11/12
Objective: Describe pedigrees.
Daily Warm-up: What is the purpose of a pedigree?
Lesson:
1) Continue genetics
2) Genetics practice
HW: Nothing
Wednesday 11/13
Objective:
Daily Warm-up: What might be the purpose of statistics??
Lesson:
1) Pedigree questions
HW: Finish Ch. 11
Thursday 11/14 or Friday 11/15
Objective: Perform a Chi-square test. Practice for the test.
Daily Warm-up: What type of trait is this?
Lesson:
1) Chi-square activity
2) Review for the test
HW: Test on Monday
Week 10: 11/4-11/8
Monday 11/4
Objective: Describe meiosis
Daily Warm-up: What is the product of mitosis?
Lesson:
1) Meiosis notes
2) Meiosis modeling
HW: Read Ch. 10, online questions due Wednesday
Tuesday 11/5
NO SCHOOL
Wednesday 11/6
Objective: Describe mitosis and meiosis
Daily Warm-up: Create a Venn diagram for mitosis and meiosis
Lesson:
1) Venn diagram discussion
2) Online questions
3) Comic strip
HW: Comic strip due Monday
Thursday 11/7 or Friday 11/8
Objective: Perform genetic crosses.
Daily Warm-up: What type of trait is this?
Lesson:
1) Genetics notes
2) Genetics practice
3) Finish online questions
HW: Read 11.1-11.2, comic strip due Monday
Objective: Describe meiosis
Daily Warm-up: What is the product of mitosis?
Lesson:
1) Meiosis notes
2) Meiosis modeling
HW: Read Ch. 10, online questions due Wednesday
Tuesday 11/5
NO SCHOOL
Wednesday 11/6
Objective: Describe mitosis and meiosis
Daily Warm-up: Create a Venn diagram for mitosis and meiosis
Lesson:
1) Venn diagram discussion
2) Online questions
3) Comic strip
HW: Comic strip due Monday
Thursday 11/7 or Friday 11/8
Objective: Perform genetic crosses.
Daily Warm-up: What type of trait is this?
Lesson:
1) Genetics notes
2) Genetics practice
3) Finish online questions
HW: Read 11.1-11.2, comic strip due Monday
Week 9: 10/28-11/1
Monday 10/28
Objective: Review information for the test
Daily Warm-up: What is the process and purpose of fermentation?
Lesson:
1) Jeopardy review
HW: Enzyme video due tomorrow
Tuesday 10/29
Objective: Apply knowledge on the test
Daily Warm-up: Begin test when ready
Lesson:
1) Unit 2 Test
HW: Nothing
Wednesday 10/30
NO CLASS- PSATs
Thursday 10/31 or Friday 11/1
Objective: Describe mitosis
Daily Warm-up: Why would cells need to divide?
Lesson:
1) Mitosis notes
2) Mitosis video
3) Modeling
4) Microscope
HW: Read 9.1-9.3, comic strip due 11/11
Objective: Review information for the test
Daily Warm-up: What is the process and purpose of fermentation?
Lesson:
1) Jeopardy review
HW: Enzyme video due tomorrow
Tuesday 10/29
Objective: Apply knowledge on the test
Daily Warm-up: Begin test when ready
Lesson:
1) Unit 2 Test
HW: Nothing
Wednesday 10/30
NO CLASS- PSATs
Thursday 10/31 or Friday 11/1
Objective: Describe mitosis
Daily Warm-up: Why would cells need to divide?
Lesson:
1) Mitosis notes
2) Mitosis video
3) Modeling
4) Microscope
HW: Read 9.1-9.3, comic strip due 11/11
Week 8: 10/21-10/25
Monday 10/21
Objective: Describe photosynthesis
Daily Warm-up: What do you remember about photosynthesis?
Lesson:
1) Photosynthesis notes
HW: Read 8.1 and 8.2
Tuesday 10/22
Objective: Describe photosynthesis
Daily Warm-up: What is the final electron acceptor in the light reactions?
Lesson:
1) Photosynthesis lab prep
HW: Finish rest of 8, prep lab
Wednesday 10/23
Objective: Describe photosynthesis
Daily Warm-up: What is the electron donor?
Lesson:
1) Photosynthesis lab
HW: Lab prepped for tomorrow
Thursday 10/24 or Friday 10/25
Objective: Describe photosynthesis
Daily Warm-up: Describe what happens in oxidative phosphorylation.
Lesson:
1) Photosynthesis lab
HW: Lab due Monday
Objective: Describe photosynthesis
Daily Warm-up: What do you remember about photosynthesis?
Lesson:
1) Photosynthesis notes
HW: Read 8.1 and 8.2
Tuesday 10/22
Objective: Describe photosynthesis
Daily Warm-up: What is the final electron acceptor in the light reactions?
Lesson:
1) Photosynthesis lab prep
HW: Finish rest of 8, prep lab
Wednesday 10/23
Objective: Describe photosynthesis
Daily Warm-up: What is the electron donor?
Lesson:
1) Photosynthesis lab
HW: Lab prepped for tomorrow
Thursday 10/24 or Friday 10/25
Objective: Describe photosynthesis
Daily Warm-up: Describe what happens in oxidative phosphorylation.
Lesson:
1) Photosynthesis lab
HW: Lab due Monday
Week 7: 10/14-10/15
Monday 10/14
Objective: Describe cellular respiration
Daily Warm-up: What did you observe during the lab?
Lesson:
1) Finish cell respiration lab
HW: Finish lab for tomorrow
Tuesday 10/15
Objective: Describe photosynthesis
Daily Warm-up: What do you know about photosynthesis?
Lesson:
1) Photosynthesis notes
2) Modeling
HW: Read 8.1 and 8.2
Objective: Describe cellular respiration
Daily Warm-up: What did you observe during the lab?
Lesson:
1) Finish cell respiration lab
HW: Finish lab for tomorrow
Tuesday 10/15
Objective: Describe photosynthesis
Daily Warm-up: What do you know about photosynthesis?
Lesson:
1) Photosynthesis notes
2) Modeling
HW: Read 8.1 and 8.2
Week 6: 10/7-10/11
Monday 10/7
Objective: Describe glycolysis
Daily Warm-up: Describe what happens in an exergonic reaction
Lesson:
1) Glycolysis notes
2) Video
3) Modeling
HW: Read 7.1-7.2
Tuesday 10/8
Objective: Describe the Krebs cycle
Daily Warm-up: How is glycolysis a piece of evidence for a common ancestor?
Lesson:
1) Krebs cycle
2) Comic strip
HW: Read 7.3
Wednesday 10/9
Objective: Describe oxidative phosphorylation.
Daily Warm-up: What happens in the Krebs cycle?
Lesson:
1) Oxidative phosphorylation
2) Modeling
3) Lab prep
HW: Intro and methods prepared for block day
Thursday 10/10 or Friday 10/11
Objective: Describe cellular respiration
Daily Warm-up: Describe what happens in oxidative phosphorylation.
Lesson:
1) Cellular respiration lab
HW: Finish Ch. 7, comic strip due next Tuesday
Objective: Describe glycolysis
Daily Warm-up: Describe what happens in an exergonic reaction
Lesson:
1) Glycolysis notes
2) Video
3) Modeling
HW: Read 7.1-7.2
Tuesday 10/8
Objective: Describe the Krebs cycle
Daily Warm-up: How is glycolysis a piece of evidence for a common ancestor?
Lesson:
1) Krebs cycle
2) Comic strip
HW: Read 7.3
Wednesday 10/9
Objective: Describe oxidative phosphorylation.
Daily Warm-up: What happens in the Krebs cycle?
Lesson:
1) Oxidative phosphorylation
2) Modeling
3) Lab prep
HW: Intro and methods prepared for block day
Thursday 10/10 or Friday 10/11
Objective: Describe cellular respiration
Daily Warm-up: Describe what happens in oxidative phosphorylation.
Lesson:
1) Cellular respiration lab
HW: Finish Ch. 7, comic strip due next Tuesday
Week 5: 9/30-10/4
Monday 9/30
Objective: Apply knowledge on the test
Daily Warm-up: None-begin test
Lesson:
1) Unit 1 Test
HW: Nothing
Tuesday 10/1
Objective: Describe enzymes
Daily Warm-up: What type of macromolecule is an enzyme?
Lesson:
1) Enzyme notes and modeling
2) Enzyme video
HW: Watch Bozeman ATP video, read 6.1-6.2
Wednesday 10/2
Objective: Describe enzymes
Daily Warm-up: Draw an enzyme and label its active site
Lesson:
1) Enzyme video creation
HW: Nothing
Thursday 10/3 or Friday 10/4
Objective: Describe enzymes
Daily Warm-up: What happens during competitive inhibition?
Lesson:
1) Enzyme video creation
HW: Nothing
Objective: Apply knowledge on the test
Daily Warm-up: None-begin test
Lesson:
1) Unit 1 Test
HW: Nothing
Tuesday 10/1
Objective: Describe enzymes
Daily Warm-up: What type of macromolecule is an enzyme?
Lesson:
1) Enzyme notes and modeling
2) Enzyme video
HW: Watch Bozeman ATP video, read 6.1-6.2
Wednesday 10/2
Objective: Describe enzymes
Daily Warm-up: Draw an enzyme and label its active site
Lesson:
1) Enzyme video creation
HW: Nothing
Thursday 10/3 or Friday 10/4
Objective: Describe enzymes
Daily Warm-up: What happens during competitive inhibition?
Lesson:
1) Enzyme video creation
HW: Nothing
Week 4: 9/23-9/27
Monday 9/23
Objective: Apply the knowledge of water potential.
Daily Warm-up: What are the differences between pinocytosis, receptor-mediated endocytosis, phagocytosis
Lesson:
1) Water Potential
HW: Lab due tomorrow
Tuesday 9/24
Objective: Describe cell communication.
Daily Warm-up: A cell with 0.1 M sucrose solution at a temperature of 30 degrees Celsius and a 0 Psi P has what as an overall Psi?
Lesson:
1) Cell communication notes
HW: Finish Ch. 5
Wednesday 9/25
Objective: Describe cell communication
Daily Warm-up: What are the 3 steps of cell communication?
Lesson:
1) Cell communication modeling and LARP
HW: Nothing
Thursday 9/26 or Friday 9/27
Objective: Review for the test.
Daily Warm-up: Create a water potential problem and solve it.
Lesson:
1) Review
HW: Test on Monday, September 30
Objective: Apply the knowledge of water potential.
Daily Warm-up: What are the differences between pinocytosis, receptor-mediated endocytosis, phagocytosis
Lesson:
1) Water Potential
HW: Lab due tomorrow
Tuesday 9/24
Objective: Describe cell communication.
Daily Warm-up: A cell with 0.1 M sucrose solution at a temperature of 30 degrees Celsius and a 0 Psi P has what as an overall Psi?
Lesson:
1) Cell communication notes
HW: Finish Ch. 5
Wednesday 9/25
Objective: Describe cell communication
Daily Warm-up: What are the 3 steps of cell communication?
Lesson:
1) Cell communication modeling and LARP
HW: Nothing
Thursday 9/26 or Friday 9/27
Objective: Review for the test.
Daily Warm-up: Create a water potential problem and solve it.
Lesson:
1) Review
HW: Test on Monday, September 30
Week 3: 9/16-9/20
Monday 9/16
Objective: Describe effects of osmosis and diffusion.
Daily Warm-up: What are we doing today in the lab?
Lesson:
1) Part A of osmosis lab
HW: Nothing
Tuesday 9/17
Objective: Use work time effectively.
Daily Warm-up: What did you see yesterday?
Lesson:
1) Work time
HW: Have Part A completed and Part B ready
Wednesday 9/18
Objective: Describe the effects of osmosis and diffusion.
Daily Warm-up: What are we doing today?
Lesson:
1) Part B
HW: Part C prepared, test corrections due tomorrow
Thursday 9/19 or Friday 9/20
Objective: Describe the effects of osmosis and diffusion
Daily Warm-up: What do you think was going to happen to your cells?
Lesson:
1) Part C
2) Active transport
HW: Read 5.4
Objective: Describe effects of osmosis and diffusion.
Daily Warm-up: What are we doing today in the lab?
Lesson:
1) Part A of osmosis lab
HW: Nothing
Tuesday 9/17
Objective: Use work time effectively.
Daily Warm-up: What did you see yesterday?
Lesson:
1) Work time
HW: Have Part A completed and Part B ready
Wednesday 9/18
Objective: Describe the effects of osmosis and diffusion.
Daily Warm-up: What are we doing today?
Lesson:
1) Part B
HW: Part C prepared, test corrections due tomorrow
Thursday 9/19 or Friday 9/20
Objective: Describe the effects of osmosis and diffusion
Daily Warm-up: What do you think was going to happen to your cells?
Lesson:
1) Part C
2) Active transport
HW: Read 5.4
Week 2: 9/9-9/13
Monday 9/9
Objective: Describe macromolecules.
Daily Warm-up: What is a dehydration reaction?
Lesson:
1) Macromolecule quiz
2) Protein discussion/notes
HW: Read 3.5-3.6
Tuesday 9/10
Objective: Describe the cell membrane.
Daily Warm-up: What is the only thing that varies between amino acids?
Lesson:
1) Finish proteins
2) Cell membrane discussion
HW: Read 5.1
Wednesday 9/11
Objective: Describe the cell membrane.
Daily Warm-up: Describe this photo.
Lesson:
1) Bubble lab
HW: Lab prepped for Monday
Friday 9/13
Objective: Describe cellular transport.
Daily Warm-up: What happened with the string yesterday?
Lesson:
1) Bubble lab
2) Transport notes
3) Modeling
4) Prep for lab
HW: Read 5.1-5.3, lab prepped, sheet completed
Monday 9/9
Objective: Describe macromolecules.
Daily Warm-up: What is a dehydration reaction?
Lesson:
1) Macromolecule quiz
2) Protein discussion/notes
HW: Read 3.5-3.6
Tuesday 9/10
Objective: Describe the cell membrane.
Daily Warm-up: What is the only thing that varies between amino acids?
Lesson:
1) Finish proteins
2) Cell membrane discussion
HW: Read 5.1
Wednesday 9/11
Objective: Describe the cell membrane.
Daily Warm-up: Describe this photo.
Lesson:
1) Bubble lab
HW: Lab prepped for Monday
Friday 9/13
Objective: Describe cellular transport.
Daily Warm-up: What happened with the string yesterday?
Lesson:
1) Bubble lab
2) Transport notes
3) Modeling
4) Prep for lab
HW: Read 5.1-5.3, lab prepped, sheet completed
Week 1: 9/3-9/6
Tuesday 9/3
Objective: Apply knowledge on the test
Daily Warm-up: Nothing
Lesson:
1) Summer homework test
HW: Nothing
Wednesday 9/4
Objective: Apply knowledge on the test
Daily Warm-up: Nothing
Lesson:
1) Summer homework test
HW: Nothing
Friday 9/6
Objective: Describe macromolecules
Daily Warm-up: What does mono mean? Poly?
Lesson:
1) AP Biology class registration
2) Macromolecule jigsaw
HW: Read 3.1-3.4, fill in sheet to be checked off on Monday, quiz on Monday over macromolecules, watch the Bozeman Biology macromolecule video (click here)
Tuesday 9/3
Objective: Apply knowledge on the test
Daily Warm-up: Nothing
Lesson:
1) Summer homework test
HW: Nothing
Wednesday 9/4
Objective: Apply knowledge on the test
Daily Warm-up: Nothing
Lesson:
1) Summer homework test
HW: Nothing
Friday 9/6
Objective: Describe macromolecules
Daily Warm-up: What does mono mean? Poly?
Lesson:
1) AP Biology class registration
2) Macromolecule jigsaw
HW: Read 3.1-3.4, fill in sheet to be checked off on Monday, quiz on Monday over macromolecules, watch the Bozeman Biology macromolecule video (click here)